Gene name |
SPBP23A10.16 |
Gene ID |
05/G11 |
Gene synonyms/obsolete |
sdh4 |
Gene product |
succinate
dehydrogenase (ubiquinone) (cytochrome b small subunit);
membrane anchor subunit; inner membrane translocase component;
involved in mitochondrial electron transport, succinate to
ubiquinone; involved in tricarboxylic acid cycle; involved in
protein-membrane targeting; involved in protein-mitochondrial
targeting; protein binding activity |
Entry clone |
Cloned |
ORF length (unspliced) |
561 |
ORF length (spliced) |
|
Entry clone length |
561 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBP23A10.16.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCCAATAATGTGGACAC |
Rev primer name |
SPBP23A10.16.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAGATTTCCAAAGCTTTTTA |
Amino acid length |
186 |
Molecular weight |
20.7 |
Isoelectric point (calc.) |
10.1 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
141 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |