| Gene name |
SPAC4G8.10 |
| Gene ID |
05/F02 |
| Gene synonyms/obsolete |
gos1 |
| Gene product |
SNARE; 1 predicted
transmembrane helix; involved in transport from the ER to the
Golgi apparatus as well as in intra-Golgi transport (By
similarity); GOSR1 family |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
549 |
| ORF length (spliced) |
|
| Entry clone length |
549 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC4G8.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTCTATGCTTTTGAG |
| Rev primer name |
SPAC4G8.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGAAAAAAAAGGAACAAA |
| Amino acid length |
182 |
| Molecular weight |
21 |
| Isoelectric point (calc.) |
8.9 |
| Signal SEQ |
Predicted
(C-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LALLISVLML |
| Localization (YFP) |
Golgi |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |