Gene name |
SPAC4G8.10 |
Gene ID |
05/F02 |
Gene synonyms/obsolete |
gos1 |
Gene product |
SNARE; 1 predicted
transmembrane helix; involved in transport from the ER to the
Golgi apparatus as well as in intra-Golgi transport (By
similarity); GOSR1 family |
Entry clone |
Cloned# |
ORF length (unspliced) |
549 |
ORF length (spliced) |
|
Entry clone length |
549 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC4G8.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTCTATGCTTTTGAG |
Rev primer name |
SPAC4G8.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGAAAAAAAAGGAACAAA |
Amino acid length |
182 |
Molecular weight |
21 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
Predicted
(C-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LALLISVLML |
Localization (YFP) |
Golgi |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |