Gene name |
SPAC186.04c |
Gene ID |
05/C09 |
Gene synonyms/obsolete |
|
Gene product |
putative pseudogene;
similar to N-terminal of transmembrane channel |
Entry clone |
Cloned |
ORF length (unspliced) |
528 |
ORF length (spliced) |
|
Entry clone length |
528 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
162T:C / 336T:C |
Comments |
pseudogene |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC186.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACACTTCTTCACGAAT |
Rev primer name |
SPAC186.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATCGTTTACTCTGATCCGTG |
Amino acid length |
175 |
Molecular weight |
19.5 |
Isoelectric point (calc.) |
10.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |