Gene name |
SPAC2C4.05 |
Gene ID |
04/F12 |
Gene synonyms/obsolete |
|
Gene product |
ER-derived vesicle
protein; cornichon family; 3 predicted transmembrane helices;
predicted N-terminal signal sequencesimilar to Sp SPAC30C2.05
|
Entry clone |
Cloned |
ORF length (unspliced) |
492 |
ORF length (spliced) |
405 |
Entry clone length |
492 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC2C4.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGTCTGCTTGGATTTA |
Rev primer name |
SPAC2C4.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTCGTCCACAAGTCTACTG |
Amino acid length |
134 |
Molecular weight |
15.7 |
Isoelectric point (calc.) |
8.2 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
3 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |