Gene name |
SPBC2G2.04c |
Gene ID |
04/F06 |
Gene synonyms/obsolete |
mmf1; pmf1 |
Gene product |
eukaryotic conserved
protein; endoribonuclease L-PSP; YjgF family; involved in
mitochondrial protein synthesis; involved in mitochondrial DNA
maintenance; involved in heat shock response; heat-induced
protein; links isoleucine biosynthesis and intact mitochondria
maintenance; functionally complements Sc YIL051C; similar to
Sp mmf2 (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
489 |
ORF length (spliced) |
|
Entry clone length |
489 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC2G2.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCTTAGAGCTTTAGGAAG |
Rev primer name |
SPBC2G2.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCAAGAGCGATGCATTCA |
Amino acid length |
162 |
Molecular weight |
17.5 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |