Gene name |
SPBC31F10.02 |
Gene ID |
04/E10 |
Gene synonyms/obsolete |
|
Gene product |
thioesterase
superfamily protein; human homolog is a novel candidate
oncogene MCT-1 involved in cell cycle progression and; has
multiple copies in T-cell malignancies; potential destruction
box (D-box); non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
486 |
ORF length (spliced) |
|
Entry clone length |
486 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
(-6)T:deletion |
Comments |
5' terminus is
frameshifted. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC31F10.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAATTAATAGCTCTGG |
Rev primer name |
SPBC31F10.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCTTCGGCTAAGTCAAGG |
Amino acid length |
161 |
Molecular weight |
17.1 |
Isoelectric point (calc.) |
7.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTDLGGSLAL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |