| Gene name |
SPAC17A2.15 |
| Gene ID |
04/E08 |
| Gene synonyms/obsolete |
|
| Gene product |
dubious |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
357 |
| ORF length (spliced) |
210 |
| Entry clone length |
357 |
| No. of intron |
1 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned yet |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPAC17A2.15.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAAGAGCTTTGCTTTT |
| Rev primer name |
SPAC17A2.15.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAATCGTGCAAACGAGCG |
| Amino acid length |
69 |
| Molecular weight |
8.3 |
| Isoelectric point (calc.) |
10.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
|
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|