Gene name |
SPAC17A2.15 |
Gene ID |
04/E08 |
Gene synonyms/obsolete |
|
Gene product |
dubious |
Entry clone |
#Not cloned yet |
ORF length (unspliced) |
357 |
ORF length (spliced) |
210 |
Entry clone length |
357 |
No. of intron |
1 |
Sequence status |
#Not cloned yet |
Sequence results |
#Not cloned yet |
Comments |
|
Polymerase used for cloning |
|
Fwd primer name |
SPAC17A2.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAAGAGCTTTGCTTTT |
Rev primer name |
SPAC17A2.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAATCGTGCAAACGAGCG |
Amino acid length |
69 |
Molecular weight |
8.3 |
Isoelectric point (calc.) |
10.7 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
|
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
|
Localization (YFP) |
not cloned |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|