Gene name |
SPCC74.05 |
Gene ID |
04/D12 |
Gene synonyms/obsolete |
rpl2702; rpl27b;
rpl27-2 |
Gene product |
60S ribosomal protein
L27 |
Entry clone |
Cloned |
ORF length (unspliced) |
480 |
ORF length (spliced) |
411 |
Entry clone length |
480 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
358A:T |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPCC74.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTGAAGATTTTGAAGCC |
Rev primer name |
SPCC74.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGAAGCGCAAGGGAGTAAAA |
Amino acid length |
136 |
Molecular weight |
15.3 |
Isoelectric point (calc.) |
11.4 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |