Gene name |
SPAC6G9.11 |
Gene ID |
03/E08 |
Gene synonyms/obsolete |
snc1 |
Gene product |
synaptobrevin;
essential; involved in membrane trafficking; involved in
vesicular transport (required); involved in cytokinesis;
involved in cellular elongation; deletion mutant results in
round cells (frequent); deletion mutant results in short
cylindrical cells (frequent) |
Entry clone |
Cloned |
ORF length (unspliced) |
430 |
ORF length (spliced) |
366 |
Entry clone length |
430 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC6G9.11.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGAGCCATATGACCC |
Rev primer name |
SPAC6G9.11.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACTTGCCATGAAATTTTGTT |
Amino acid length |
121 |
Molecular weight |
13.4 |
Isoelectric point (calc.) |
10.4 |
Signal SEQ |
|
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER; Golgi; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |