| Gene name |
SPAC6G9.11 |
| Gene ID |
03/E08 |
| Gene synonyms/obsolete |
snc1 |
| Gene product |
synaptobrevin;
essential; involved in membrane trafficking; involved in
vesicular transport (required); involved in cytokinesis;
involved in cellular elongation; deletion mutant results in
round cells (frequent); deletion mutant results in short
cylindrical cells (frequent) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
430 |
| ORF length (spliced) |
366 |
| Entry clone length |
430 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC6G9.11.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGAGCCATATGACCC |
| Rev primer name |
SPAC6G9.11.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACTTGCCATGAAATTTTGTT |
| Amino acid length |
121 |
| Molecular weight |
13.4 |
| Isoelectric point (calc.) |
10.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
ER; Golgi; cytoplasmic
dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |