Gene name |
SPBC1105.13c |
Gene ID |
03/E06 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
sequence orphan; low correlation score; has transcript profile
on microarray |
Entry clone |
Cloned |
ORF length (unspliced) |
429 |
ORF length (spliced) |
|
Entry clone length |
429 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
(-15~-12):deletion /
347G:A |
Comments |
5' terminus is
frameshifted; Abnormal attB1 sequence. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC1105.13.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATCACGGAATTCATCAA |
Rev primer name |
SPBC1105.13.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTCAACTTAACGAAGTGC |
Amino acid length |
142 |
Molecular weight |
16.3 |
Isoelectric point (calc.) |
5.8 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
ER; cytoplasmic
dots |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Confocal,
DeltaVision |