| Gene name |
SPBP4H10.08 |
| Gene ID |
03/E04 |
| Gene synonyms/obsolete |
qcr10 |
| Gene product |
low similarity to
ubiquinol-cytochrome |
| Entry clone |
Cloned |
| ORF length (unspliced) |
428 |
| ORF length (spliced) |
240 |
| Entry clone length |
428 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
27T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBP4H10.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTTCTTTCGTAAGTTT |
| Rev primer name |
SPBP4H10.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAACCACTTGTCTTCTTCA |
| Amino acid length |
79 |
| Molecular weight |
9.1 |
| Isoelectric point (calc.) |
10.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |