| Gene name |
SPAC4G8.01c |
| Gene ID |
03/D09 |
| Gene synonyms/obsolete |
SPAC22G7.11c |
| Gene product |
hypothetical protein;
similar to N. crassa conidiation-specific protein 6 |
| Entry clone |
Cloned in 2006
trial |
| ORF length (unspliced) |
423 |
| ORF length (spliced) |
|
| Entry clone length |
423 |
| No. of intron |
0 |
| Sequence status |
Partially
sequenced |
| Sequence results |
100% match in both
ends |
| Comments |
5' terminus is
frameshifted. |
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC4G8.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCTGATCCTAATCGTGT |
| Rev primer name |
SPAC4G8.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGCTTGGGTTTCATCATCA |
| Amino acid length |
140 |
| Molecular weight |
15.4 |
| Isoelectric point (calc.) |
4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |