| Gene name |
SPBC3B9.18c |
| Gene ID |
03/D07 |
| Gene synonyms/obsolete |
vma7 |
| Gene product |
putative vacuolar ATP
synthase subunit F; vacuolar ATP synthase (subunit F);
vacuolar proton pump component; V1 sector |
| Entry clone |
Cloned |
| ORF length (unspliced) |
421 |
| ORF length (spliced) |
363 |
| Entry clone length |
421 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
(-7)C:deletion / 78A:G
/ 282T:C |
| Comments |
5' terminus is
frameshifted. |
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC3B9.18.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCACAATCATATCG |
| Rev primer name |
SPBC3B9.18.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCTCCAATGATCTTTCTA |
| Amino acid length |
120 |
| Molecular weight |
13.6 |
| Isoelectric point (calc.) |
4.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |