Gene name |
SPAC19B12.09 |
Gene ID |
03/C03 |
Gene synonyms/obsolete |
srp14 |
Gene product |
protein signal
sequence binding activity; localization signal recognition
particle; involved in intracellular protein transport;
involved in protein-ER targeting; involved in SRP-dependent
cotranslational membrane targeting |
Entry clone |
Cloned |
ORF length (unspliced) |
413 |
ORF length (spliced) |
321 |
Entry clone length |
413 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC19B12.09.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGTTGAGCAATGAAGA |
Rev primer name |
SPAC19B12.09.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATGTATGCCCCGAAGAAGTG |
Amino acid length |
106 |
Molecular weight |
11.7 |
Isoelectric point (calc.) |
10 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
86/85 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |