Gene name |
SPBC4B4.05 |
Gene ID |
02/E05 |
Gene synonyms/obsolete |
smg1 |
Gene product |
small nuclear
ribonucleoprotein; involved in mRNA splicing; complexed with
Cdc5p |
Entry clone |
Cloned |
ORF length (unspliced) |
365 |
ORF length (spliced) |
234 |
Entry clone length |
365 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
269G:A |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC4B4.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTAAAGCTGGTGCGCC |
Rev primer name |
SPBC4B4.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGTCATTTTATCCAAAGTC |
Amino acid length |
77 |
Molecular weight |
8.6 |
Isoelectric point (calc.) |
8.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |