| Gene name |
SPAC25G10.06 |
| Gene ID |
02/D04 |
| Gene synonyms/obsolete |
rps2801; rps28-1 |
| Gene product |
40S ribosomal protein
S28 |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
356 |
| ORF length (spliced) |
207 |
| Entry clone length |
356 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
6T:C/ 99T:deletion/
352G:T |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC25G10.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCTTCTAAGGTTCC |
| Rev primer name |
SPAC25G10.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACGCAATCTTCTGGCCTCA |
| Amino acid length |
68 |
| Molecular weight |
7.6 |
| Isoelectric point (calc.) |
11.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
cytosol>nucleus |
| Microscope used for
observation |
DeltaVision |