Gene name |
SPBC30B4.10 |
Gene ID |
01/H03 |
Gene synonyms/obsolete |
SPBC30B4.09b;
SPBC27B12.02 |
Gene product |
mitochondrial outer
membrane protein; involved in mitochondrial biogenesis;
involved in coupling mitochondria to the actin
cytoskeleton |
Entry clone |
Cloned |
ORF length (unspliced) |
330 |
ORF length (spliced) |
|
Entry clone length |
330 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
123T:C |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC30B4.09b.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGTTAGAAAAAGCAAG |
Rev primer name |
SPBC30B4.09b.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACATTTTTACTGCTCTAACA |
Amino acid length |
109 |
Molecular weight |
13 |
Isoelectric point (calc.) |
11.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
1 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
mitochondrion |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |