| Gene name |
SPBC30B4.10 |
| Gene ID |
01/H03 |
| Gene synonyms/obsolete |
SPBC30B4.09b;
SPBC27B12.02 |
| Gene product |
mitochondrial outer
membrane protein; involved in mitochondrial biogenesis;
involved in coupling mitochondria to the actin
cytoskeleton |
| Entry clone |
Cloned |
| ORF length (unspliced) |
330 |
| ORF length (spliced) |
|
| Entry clone length |
330 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
123T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC30B4.09b.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGTTAGAAAAAGCAAG |
| Rev primer name |
SPBC30B4.09b.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACATTTTTACTGCTCTAACA |
| Amino acid length |
109 |
| Molecular weight |
13 |
| Isoelectric point (calc.) |
11.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
mitochondrion |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Zeiss |