Gene name |
SPAC3F10.15c |
Gene ID |
01/C02 |
Gene synonyms/obsolete |
spo12 |
Gene product |
involved in
sporulation; overexpression suppresses the phenotype of the
mcs3-12 wee1-50 cdc25-22; overexpression suppresses the
phenotype win1-1 wee1-50 cdc25-22 strain at high temperature;
non-essential; involved in cytokinesis (required); involved in
septation (required); expression peaks at M-G1 phase;
regulated by PBF transcription complex |
Entry clone |
Cloned |
ORF length (unspliced) |
273 |
ORF length (spliced) |
|
Entry clone length |
273 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC3F10.15.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCAGAAACTCAAGCTGA |
Rev primer name |
SPAC3F10.15.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCTTTTTCTGTCTGGACG |
Amino acid length |
90 |
Molecular weight |
10.1 |
Isoelectric point (calc.) |
9.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |